View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14991_low_4 (Length: 312)
Name: NF14991_low_4
Description: NF14991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14991_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 90 - 303
Target Start/End: Original strand, 4702586 - 4702799
Alignment:
| Q |
90 |
aggtttgttgctttgctaatttttgttgttgtgaataatttgttaaatcatacgatgccctatgaattattaaagtgatgcccttctgagtatgtatact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4702586 |
aggtttgttgctttgctaatttttgttgttgtgaataatttgttaaatcataagatgccgtatgaagtattaaagtgatgcccttctgagtatgtatact |
4702685 |
T |
|
| Q |
190 |
tactgaacctatttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggcagattctgccatatgcaaaaagaaaaggaatggagagtggtc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702686 |
tactgaacctatttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaatggagagtggtc |
4702785 |
T |
|
| Q |
290 |
aaatatgccctatg |
303 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
4702786 |
aaatatgccttatg |
4702799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 4702527 - 4702590
Alignment:
| Q |
1 |
attatataccaccactagtctctggtgattttgctattacttcttttatttacagactaaggtt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4702527 |
attatataccaccactagtctctggtgattttgctattgcttcttttatttacagactaaggtt |
4702590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 178 - 272
Target Start/End: Original strand, 4706046 - 4706141
Alignment:
| Q |
178 |
agtatgtatacttactgaacct-atttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggcagattctgccatatgcaaaaagaaa |
272 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
4706046 |
agtatgtatacttactgaaccttatttacattgtttagttaaacaaagtggaataccaagatgtcggaggttgattctgccatctgcaaaatgaaa |
4706141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 4705801 - 4705861
Alignment:
| Q |
1 |
attatataccaccactagtctctggtgattttgcta-ttacttcttttatttacagactaa |
60 |
Q |
| |
|
||||| |||| | |||| |||||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
4705801 |
attatgtaccgctactaatctctggtgattttgctatttacttctttcatttatagactaa |
4705861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University