View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14992_high_4 (Length: 274)
Name: NF14992_high_4
Description: NF14992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14992_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 24 - 139
Target Start/End: Complemental strand, 32742007 - 32741892
Alignment:
| Q |
24 |
tccaaacgaaactcaccgttcacccatagcttccgccatcgaaaacggcatcatttgggactccgtttactttattcgtgccgctgaatgtggctacgaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742007 |
tccaaacgaaactcaccgttcacccatagcttcctccatcgaaaacggcatcatttgggactccgtttactttattcgtgccgctgaatgtggctacgaa |
32741908 |
T |
 |
| Q |
124 |
tatgaacaatcctacg |
139 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32741907 |
tatgaacaatcctacg |
32741892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 256
Target Start/End: Complemental strand, 32741814 - 32741775
Alignment:
| Q |
217 |
atcaataatctcgcttttgttctagctgctctttactttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32741814 |
atcaataatctcgcttttgttctagctgctctttactttt |
32741775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University