View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14993_low_6 (Length: 264)
Name: NF14993_low_6
Description: NF14993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14993_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 45165981 - 45166229
Alignment:
| Q |
1 |
aggccatgcctcagctaaccgacagatcaaagcttccaagtattctagatcctgttatccaaaatacaatggatttgaagcatttatatcaggttcattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165981 |
aggccatgcctcagctaaccgacagatcaaagcttccaagtattctagatcctgttatccaaaatacaatggatttgaagcatttatatcaggttcattg |
45166080 |
T |
|
| Q |
101 |
aatagaagtactgtaatcacatgttttaatgctgagtgttaaatgctagtacttcttaattcatctcaacattctactctacaggtagctgcagtggctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166081 |
aatagaagtactgtaatcacatgttttaatgctgagtgttaaatgctagtacttcttaattcatctcaacattctactctacaggtagctgcagtggctg |
45166180 |
T |
|
| Q |
201 |
tgctatgtgtgcaagctgaaccaagttacaggccacttataacagatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45166181 |
tgctatgtgtgcaagctgaaccaagttataggccacttataacagatgt |
45166229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 249
Target Start/End: Complemental strand, 49121063 - 49120997
Alignment:
| Q |
183 |
aggtagctgcagtggctgtgctatgtgtgcaagctgaaccaagttacaggccacttataacagatgt |
249 |
Q |
| |
|
|||| ||||| || |||||||||||||||||| | || ||||||||| ||||||| || |||||||| |
|
|
| T |
49121063 |
aggttgctgcggtagctgtgctatgtgtgcaaccagagccaagttaccggccactaatcacagatgt |
49120997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University