View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14993_low_7 (Length: 232)
Name: NF14993_low_7
Description: NF14993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14993_low_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 55643182 - 55642963
Alignment:
| Q |
13 |
aatatgagttctcttgaccaaccatgctttacctgaagtatataagagtcattaatatatttctttgtgatcaattggacgcatagtttatctgaattat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55643182 |
aatatgagttctcttgaccaaccatgctttacctgaagtatgtaagagtcattaatatatttctttgtgatcaattggacccatagtttatctgaattat |
55643083 |
T |
 |
| Q |
113 |
gatagcaaggccacctctttaaggggattgagtaatagtattctactctatctaatattaagtattgccatcccagataaattgtatgatactagagtca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55643082 |
gatagcaaggccacctctttaaggggattgagtaatagtattctactctatctaatattaagtattgccatcccaaataaattgtatgatactagagtca |
55642983 |
T |
 |
| Q |
213 |
ctcttattgcatatatcatc |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
55642982 |
atcttattgcatatatcatc |
55642963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University