View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14994_high_16 (Length: 212)
Name: NF14994_high_16
Description: NF14994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14994_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 64 - 155
Target Start/End: Original strand, 20700314 - 20700405
Alignment:
| Q |
64 |
gatttcacgtcaagaaaggagaggacttcggcgatgagatcatccggaagggtcactggcgaaggagggttgatttcacgccgagacttaga |
155 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||| ||| | || |||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
20700314 |
gatttcacgtcaagaaaggccaggacttccgcgatgagatcatccgggaggattaccggcgaaggagagttgatttcatgccgaaacttaga |
20700405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 195
Target Start/End: Complemental strand, 46300711 - 46300676
Alignment:
| Q |
160 |
ctgtgtgccgccgtggagttgatgattacttgatat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46300711 |
ctgtgtgccgccgtggagttgatgattacttgatat |
46300676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University