View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14994_low_16 (Length: 262)
Name: NF14994_low_16
Description: NF14994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14994_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 4 - 244
Target Start/End: Complemental strand, 21287602 - 21287362
Alignment:
| Q |
4 |
aagtcaagaaatagagctgaagaattgcttgtagaattgagtgcaaacttgccacagcctaagtttatggatgatttagggcttgatgatgaccttttga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21287602 |
aagtcaagaaatagagctgaagaattgcttgtagaattgagtgcaaacttgccacagcctaagtttatggatgatttagggcttgatgatgaccttttga |
21287503 |
T |
 |
| Q |
104 |
aaggaattgatggattacttaatgtttggagtccaactagatcaagaagacttcccatctttgaggaaatatcttcttttagagatcaattggcatgtta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21287502 |
aaggaattgatggattacttaatgtttggagtccaactagatcaagaagacttcccatctttgaggaaatatcttcttttagagatcaattggcatgtta |
21287403 |
T |
 |
| Q |
204 |
atatttgtattcatgttcttatgttgtatatattgtcttag |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21287402 |
atatttgtattcatgttcttatgttgtatatattgtcttag |
21287362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University