View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14994_low_16 (Length: 262)

Name: NF14994_low_16
Description: NF14994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14994_low_16
NF14994_low_16
[»] chr7 (1 HSPs)
chr7 (4-244)||(21287362-21287602)


Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 4 - 244
Target Start/End: Complemental strand, 21287602 - 21287362
Alignment:
4 aagtcaagaaatagagctgaagaattgcttgtagaattgagtgcaaacttgccacagcctaagtttatggatgatttagggcttgatgatgaccttttga 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21287602 aagtcaagaaatagagctgaagaattgcttgtagaattgagtgcaaacttgccacagcctaagtttatggatgatttagggcttgatgatgaccttttga 21287503  T
104 aaggaattgatggattacttaatgtttggagtccaactagatcaagaagacttcccatctttgaggaaatatcttcttttagagatcaattggcatgtta 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21287502 aaggaattgatggattacttaatgtttggagtccaactagatcaagaagacttcccatctttgaggaaatatcttcttttagagatcaattggcatgtta 21287403  T
204 atatttgtattcatgttcttatgttgtatatattgtcttag 244  Q
    |||||||||||||||||||||||||||||||||||||||||    
21287402 atatttgtattcatgttcttatgttgtatatattgtcttag 21287362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University