View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14994_low_19 (Length: 225)
Name: NF14994_low_19
Description: NF14994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14994_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 36 - 208
Target Start/End: Complemental strand, 35408382 - 35408210
Alignment:
| Q |
36 |
gagaaaactcacagaaacaatctcgatcacaaaagccagagcgaggacgaaaataatggtatccttgagatataaaattttagccattgaagtcttgttt |
135 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35408382 |
gagaaaactcacagaaacaatcttgattacaaaagccagagcgaggacgaaaataatggtatccttgagatataaaattttagccattgaagtcttgttt |
35408283 |
T |
|
| Q |
136 |
gatatatccttcaacctctacaaatgaagatgaagatgactagtattcctatgatacagcatttgtgagcaag |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35408282 |
gatatatccttcagcctctacaaatgaagatgaagatgactagtattcctatgatacagcatttgtgagcaag |
35408210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 20873267 - 20873353
Alignment:
| Q |
36 |
gagaaaactcacagaaacaatctcgatcacaaaagccagagcgaggacgaaaataatggtatccttgagatataaaattttagccat |
122 |
Q |
| |
|
||||||||||||||| |||| | |||||||| ||||| || |||| |||| |||||| ||| ||||||||| |||||||||||| |
|
|
| T |
20873267 |
gagaaaactcacagagacaaattggatcacaatagccatggcaaggatgaaagtaatggcatctctgagatatacaattttagccat |
20873353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University