View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14995_low_4 (Length: 296)
Name: NF14995_low_4
Description: NF14995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14995_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 14 - 276
Target Start/End: Complemental strand, 35042792 - 35042519
Alignment:
| Q |
14 |
agaattacaacggttcagatttgatgtaaatcaatatctatctaagaaacgattaattcgatgagttcaatccaactgttcacttgagttgcaagttact |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35042792 |
agaattacaacggttcagatttgatgtaaatcaatatctatctaagaaacgattaattcgatgagttcaatccaaccgttcacttgagttgcaagttact |
35042693 |
T |
|
| Q |
114 |
atattatggattaaatgcaaggtaaattacgtact-----------taataatgattaaattgtgcagtgcttatgggaacgtagggttgtcaacaggat |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042692 |
atattatggattaaatgcaaggtatattacgtactaatgggtaacattatgatgattaaattgtgcagtgcttatgggaacgtagggttgtcaacaggat |
35042593 |
T |
|
| Q |
203 |
atagctgctcaagacaattgaaacctaatttaatgtgcaaagattcatggattggattttcaggtagatggagt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35042592 |
atagctgctcaagacaattgaaacctaatttaatgtgcagagattcatggattggattttcaggtagatggagt |
35042519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 166 - 277
Target Start/End: Complemental strand, 34989067 - 34988956
Alignment:
| Q |
166 |
tgcagtgcttatgggaacgtagggttgtcaacaggatatagctgctcaagacaattgaaacctaatttaatgtgcaaagattcatggattggattttcag |
265 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| || ||||| |||||||||| | |||||||||||||||||||||||||||||||||| | |
|
|
| T |
34989067 |
tgcagtgcttatgggaacgtagggttttcaacaggatatagttgttcaaggcaattgaaacatgatttaatgtgcaaagattcatggattggattttctg |
34988968 |
T |
|
| Q |
266 |
gtagatggagtg |
277 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
34988967 |
gtaggtggagtg |
34988956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 263
Target Start/End: Original strand, 15560102 - 15560131
Alignment:
| Q |
234 |
aatgtgcaaagattcatggattggattttc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15560102 |
aatgtgcaaagattcatggattggattttc |
15560131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University