View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14996_low_10 (Length: 208)

Name: NF14996_low_10
Description: NF14996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14996_low_10
NF14996_low_10
[»] chr8 (1 HSPs)
chr8 (19-198)||(3916161-3916340)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 3916340 - 3916161
Alignment:
19 ttagttctccttgttacggcgattctgaacggacacaccgaagctgccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggt 118  Q
    |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3916340 ttagttctccttgttacggcgattctgaacggccacatcgaagctgccggtagaggagctgaaccaccaaaggatggaagtgtttacgaacccgaagggt 3916241  T
119 atggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttggcctttg 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3916240 atggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttggcctttg 3916161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University