View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14996_low_11 (Length: 205)
Name: NF14996_low_11
Description: NF14996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14996_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 26 - 142
Target Start/End: Complemental strand, 29638196 - 29638080
Alignment:
| Q |
26 |
atatatagcccatcccaccaacaaaagaagaatgtcatcgactggtaggcaacgtattccttttgagttttgctttgtgtcgtaataaataaataaacta |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
29638196 |
atatatagcccatcccaccaacaaaagaagaatgtcatcgactggtaggcaacgtattccttttgagttttgccttttgtcgtaataaataaataaacta |
29638097 |
T |
 |
| Q |
126 |
tacacaacattattgtt |
142 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29638096 |
tacacaacattattgtt |
29638080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University