View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14997_low_10 (Length: 216)
Name: NF14997_low_10
Description: NF14997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14997_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 31836524 - 31836714
Alignment:
| Q |
11 |
aatttgtttcatagcagttcatataaataagtactagttgcactatgtagtatttgtgagaaattaataaaagttctcaagcttccctaatctctttctc |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836524 |
aatttgttacatagcagttcatataaataagtactagttgcactatgtagtgtgtgtgagaaattaataaaagttctcaagcttccctaatctctttctc |
31836623 |
T |
|
| Q |
111 |
tctgttctgttacataccatttagcaatctgcaaccaatttcaacataagcttccatttaatatgttggctggattaatctcaacagaatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31836624 |
tctgttctgttacataccatttagcaatctgcaaccaatttcaacataagcttccatttaatatgttggctggattaatctcaacagaatt |
31836714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University