View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14997_low_9 (Length: 237)
Name: NF14997_low_9
Description: NF14997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14997_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 40405729 - 40405510
Alignment:
| Q |
9 |
acctgtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagctttaaagtttctgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40405729 |
acctgtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagctttaaagtttctgt |
40405630 |
T |
 |
| Q |
109 |
ttttggaattttgcacttacccctatgtgttgatatctccgccacg-----ccacaaagatcaggcaggttgttcgatgaattcggtattgtgctggtgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40405629 |
ttttggaattttgcacttacccctatgtgttgatatctccgccacgccacgccacaaagatcaggcaggttgttcgatgaatttggtattgtgctggtgg |
40405530 |
T |
 |
| Q |
204 |
tggttcaggttgctcctttt |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40405529 |
tggttcaggttgctcctttt |
40405510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 29026429 - 29026345
Alignment:
| Q |
13 |
gtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagcttt |
97 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||| || ||||| || | |||||||||| || ||||| |||||||||| |
|
|
| T |
29026429 |
gtggagaagaatgagtattttgtgcttgatgaggaggaggaagaagctgcggaggttgctctcagggaagaagagtttgagcttt |
29026345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University