View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14998_low_3 (Length: 240)
Name: NF14998_low_3
Description: NF14998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14998_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37068315 - 37068074
Alignment:
| Q |
1 |
tctagcgcaagtaattgatgcacta------aatatgtgagtgttctaattctaaaccaaggtaccga-------------ccggtcacaaaaaataaag |
81 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37068315 |
tctagcgcaagtaattgatgcactatgactgaatatgtgagtgttctaattctaaaccaaggtaccgaatttgatttcctaccggtcacaaaaaataaag |
37068216 |
T |
|
| Q |
82 |
tctaagttcatggtatctttctcacacacacataatttcattaatttctaatcaatacttgtatgaaatcctttcactttagacaaaagaataaattctg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37068215 |
tctaagttcatggtatctttctcacacacacataatttcattaatttctaatcaatactagtgtgaaatcctttcactttagacaaaagaataaattctg |
37068116 |
T |
|
| Q |
182 |
ttccgttaatatcgatttttgttgtctgtacccacatgtttc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37068115 |
ttccgttaatatcgatttttgttgtctgtacccacatgtttc |
37068074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University