View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14999_high_17 (Length: 276)
Name: NF14999_high_17
Description: NF14999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14999_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 3960762 - 3960621
Alignment:
| Q |
18 |
agtggatttggaatccgaaggattgccttttgaggtaataggggttgctgtctgggccctggggtctgccgtgatttggttttaggactgtttcattagt |
117 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| || || ||||||| || | || ||||| |||||| ||||| |||||||||| |
|
|
| T |
3960762 |
agtggatgtggaatctgaaggattgccttttgaggtaataggagtcgcggtctggg-------gttttccttgattcggttttgggactatttcattagt |
3960670 |
T |
 |
| Q |
118 |
ccgttgggagctctgcaagcggtttgggtttttgccttgctgctgtctt |
166 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3960669 |
ccgttgggagctctgcaagcggttcgggtttttgccttgctgctatctt |
3960621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 3960316 - 3960230
Alignment:
| Q |
78 |
ggggtctgccgtgatttggttttaggactgtttcattagtccgttgggagctctgcaagcggtttgggtttttgccttgctgctgtc |
164 |
Q |
| |
|
||||| || ||||||| |||||| ||||||||||||||||| |||||||||||||| ||||| | |||||| ||||||||||||||| |
|
|
| T |
3960316 |
ggggtttgacgtgattcggttttgggactgtttcattagtcagttgggagctctgccagcggctcgggtttctgccttgctgctgtc |
3960230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 3960604 - 3960562
Alignment:
| Q |
154 |
ttgctgctgtcttagtttgcgcagagctgagcgcgttttttcc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3960604 |
ttgctgctgtcttagtttgcgcagagctgagcgcgttttttcc |
3960562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University