View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14999_high_20 (Length: 256)
Name: NF14999_high_20
Description: NF14999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14999_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 39177702 - 39177474
Alignment:
| Q |
12 |
gataagaatggatcagtcatttgtacgnnnnnnnaataaaaagattgtatgagtatgcttcactagtttctaataaaatctaggtgcatctgctcaactc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39177702 |
gataagaatggatcagtcatttgtacgtttttttaataaaaagattgtatgagtatgcttcactagtttctaataaaatctaggtgcatctgctcaactc |
39177603 |
T |
|
| Q |
112 |
gatgaaaaataaccttcattttagtgcatcatacatttctggaaacttatatcagagaattcttggtctcacgtaggaaaggtttaagcctttgtgtgca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39177602 |
gatgaaaaataaccttcattttagtgcatcataaatttctggaaacttatatcagagaattcttggtctcatgtaggaaaggtttaagcctttgtgtgca |
39177503 |
T |
|
| Q |
212 |
cctttgaggaactggaaaactaccctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39177502 |
cctttgaggaactggaaaactaccctctg |
39177474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 140
Target Start/End: Complemental strand, 39161689 - 39161627
Alignment:
| Q |
78 |
tttctaataaaatctaggtgcatctgctcaactcgatgaaaaataaccttcattttagtgcat |
140 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39161689 |
tttctaataatatcaaagtgcatctgctcaactcgatgaaaaataaccttcattttagtgcat |
39161627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 140
Target Start/End: Complemental strand, 39161736 - 39161691
Alignment:
| Q |
95 |
gtgcatctgctcaactcgatgaaaaataaccttcattttagtgcat |
140 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39161736 |
gtgcatatgctcaactcgatgaaaaataaccttcattttagtgcat |
39161691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University