View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14999_low_18 (Length: 284)
Name: NF14999_low_18
Description: NF14999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14999_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 22 - 269
Target Start/End: Original strand, 36167366 - 36167596
Alignment:
| Q |
22 |
atgatatggggcaatgactattctagagaggaatgatgatgtgtgccatctgccatgttttgaatttctcatcacgggatttgaaagtctatatgtaact |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36167366 |
atgatatggggcaatgactattctagagaggaatgatgatgtgtgccatctgccatgttttgaatttctcatcacgggatttgaaagtctatatttaact |
36167465 |
T |
|
| Q |
122 |
aatttaaatataacacgtttatttccgaaannnnnnnaaaaaggaaaatgaaacgattatttttatatattttagtgacatgcaaccggtatggacagat |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167466 |
aatttaaatataacacgttt-----------------aaaaaggaaaatgaaacgattatttttatatattttagtgacatgcaaccggtatggacagat |
36167548 |
T |
|
| Q |
222 |
attttgagagattcaccacaaaaaagaaagatattttgagagattgag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167549 |
attttgagagattcaccacaaaaaagaaagatattttgagagattgag |
36167596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University