View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14999_low_22 (Length: 259)
Name: NF14999_low_22
Description: NF14999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14999_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 21557766 - 21557917
Alignment:
| Q |
13 |
aatatcttatgtaaaaatagggtaagttttatggtttagggtttcatacaatacatcaaaatagtgaaactccttttaggaccctactaattgttggttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||| ||||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21557766 |
aatatcttatgtaaaaatagggtaagttttagggtttatggtttcgtacaatacaccaaaatggtgaaactccttttaggaccctattaattgttggttt |
21557865 |
T |
 |
| Q |
113 |
cgctatgtgacgctatcatttatgataagttgtgtgctaatatacttttcct |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21557866 |
cgctatgtgacgctatcatttatgataagttgtgtgctaatatacttttcct |
21557917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University