View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1499_high_22 (Length: 380)

Name: NF1499_high_22
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1499_high_22
NF1499_high_22
[»] chr1 (1 HSPs)
chr1 (259-380)||(38822497-38822618)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 259 - 380
Target Start/End: Original strand, 38822497 - 38822618
Alignment:
259 ttttgatatccaattttctgtgtctgatgactttcaaaatgaatgtcattttcggtccagatgtgccaatctgaacttttgtgttggacattcgtgtctt 358  Q
    |||||| ||||||||||||||||| |||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||    
38822497 ttttgacatccaattttctgtgtcggatgacttgcaaaatgaatgtcattttcggttcagatgcgccaatctgaacttttgtgttggacattcgtgtctt 38822596  T
359 attattctgctaagtggtaatt 380  Q
    ||||||||||||| ||||||||    
38822597 attattctgctaattggtaatt 38822618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University