View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_high_27 (Length: 354)
Name: NF1499_high_27
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 16 - 336
Target Start/End: Original strand, 30684475 - 30684795
Alignment:
| Q |
16 |
atgattacaagaggaaagataaactccgtcaacctctcactgagatcaatgatttaccaggacatgcttatttgaacaagaagagtggatggccaactcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30684475 |
atgattacaagaggaaagataaactccgtcaacctctcactgagatcagtgatttaccaggacatgcttatttgaacaagaagagtggatggccaactcc |
30684574 |
T |
|
| Q |
116 |
atcacctagtatgttcgttattctgttggtcgtcgtttcacactactgctatcttgtgttaaaggggattaagtataagtatataccaaaggataataat |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30684575 |
atcacctactatgttcgttattctgttggtcgtcgtttcacactactgctatcttgtggtaaaggggattaagtataagtatataccaaaggatactaat |
30684674 |
T |
|
| Q |
216 |
agagaagtatcgatgaactttaatgaaggtgttgatggagaaataattggcgaattattcgtttcnnnnnnngagattggccggggaaggagaaggacga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30684675 |
agagaagtatcgatgaactttaatgaaggtgttgatggagaaataattggcgaattattcgtttcaaaaaaagagattggccggggaaggagaaggacga |
30684774 |
T |
|
| Q |
316 |
atgctaccgctgtcctgcatg |
336 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30684775 |
atgctaccgctgtcctgcatg |
30684795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 85 - 123
Target Start/End: Original strand, 30976621 - 30976659
Alignment:
| Q |
85 |
atttgaacaagaagagtggatggccaactccatcaccta |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30976621 |
atttgaacaagaagagtggatggtcaactccattaccta |
30976659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University