View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_high_7 (Length: 522)
Name: NF1499_high_7
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 96 - 310
Target Start/End: Complemental strand, 31536416 - 31536202
Alignment:
| Q |
96 |
ttcttgatccctaaaacacatttatatttcatttccctctttgcccctccgacatcccttgttcctaattccaaacaaagccagcccccttggcaccccc |
195 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||||| ||||| ||||||||||| |||||||||||| ||||||||||||||||| || ||||| || | |
|
|
| T |
31536416 |
ttcttgatcactaaaacacatatataattcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagccaccatggcaaccac |
31536317 |
T |
 |
| Q |
196 |
cgcaaccgccgccaccatgtcacattttttcggcacaagtctctgcaaaccaacctcaaacatgggaagagttcgtgctttcttcaacataggtaccaag |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536316 |
cgcaaccgccgccaccatgtcacattttttcggcacaagtctctgcaaaccaacctcaaacatgggaagagttcgtgctttcttcaacataggtaccaag |
31536217 |
T |
 |
| Q |
296 |
ttaaagccagcacct |
310 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31536216 |
ttaaagccagcacct |
31536202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 349 - 506
Target Start/End: Complemental strand, 31536163 - 31536006
Alignment:
| Q |
349 |
tgatgggctagtgtggtttcctggtgctcagccaccggaatggctcgatgggacgatgatcggtgaccgtggttttgatccattgggattagccaaacct |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536163 |
tgatgggctagtgtggtttcctggtgctcagccaccggaatggctcgatgggacgatgatcggtgaccgtggttttgatccattgggattagccaaacct |
31536064 |
T |
 |
| Q |
449 |
gttgagtatctgcagtttgatcttgactcacttgaccagaacttggctaagaaccttg |
506 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536063 |
gttgagtatctgcagtttgatcttgactcacttgaccagaacttggctaagaaccttg |
31536006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University