View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_22 (Length: 380)
Name: NF1499_low_22
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 259 - 380
Target Start/End: Original strand, 38822497 - 38822618
Alignment:
| Q |
259 |
ttttgatatccaattttctgtgtctgatgactttcaaaatgaatgtcattttcggtccagatgtgccaatctgaacttttgtgttggacattcgtgtctt |
358 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38822497 |
ttttgacatccaattttctgtgtcggatgacttgcaaaatgaatgtcattttcggttcagatgcgccaatctgaacttttgtgttggacattcgtgtctt |
38822596 |
T |
|
| Q |
359 |
attattctgctaagtggtaatt |
380 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
38822597 |
attattctgctaattggtaatt |
38822618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University