View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_43 (Length: 282)
Name: NF1499_low_43
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_43 |
 | |
|
| [»] scaffold0368 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0368 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0368
Description:
Target: scaffold0368; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 2041 - 1787
Alignment:
| Q |
21 |
aggagggaatctggaggttggcttggcagttggttttgtgctgggtttttggcttcatgagatgccattgttctgaattgtgaggtgtgggtatgcggtt |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2041 |
aggagggaacctggaggttggcttggcagttggttttgtgctgggtttttggcttcatgagatgccattgttctgaattgtgaggtgtgggtatgcggtt |
1942 |
T |
|
| Q |
121 |
ggtgcattgcacgttcgtatactccggcctcattgttttgggtagttttgaactttggcttttgagaggtgttccgtatatttgcgcaccggattgtatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1941 |
ggtgcattgcacgttcgtatactccggccttattgttttgggtagttttgaactttggcttttgagaggtgttccgtatatttgcgcaccggattgtatt |
1842 |
T |
|
| Q |
221 |
cttttgtt-ttttcgtgagtatttatgcgttttgcatttatttgacgagaataat |
274 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1841 |
cttttgtttttttcgtgagtatttatgcgttttgcatttatttgatgagaataat |
1787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 38296678 - 38296424
Alignment:
| Q |
21 |
aggagggaatctggaggttggcttggcagttggttttgtgctgggtttttggcttcatgagatgccattgttctgaattgtgaggtgtgggtatgcggtt |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38296678 |
aggagggaacctggaggttggcttggcagttggttttgtgctgggtttttggcttcatgagatgccattgttctgaattgtgaggtgtgggtatgcggtt |
38296579 |
T |
|
| Q |
121 |
ggtgcattgcacgttcgtatactccggcctcattgttttgggtagttttgaactttggcttttgagaggtgttccgtatatttgcgcaccggattgtatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38296578 |
ggtgcattgcacgttcgtatactccggccttattgttttgggtagttttgaactttggcttttgagaggtgttccgtatatttgcgcaccggattgtatt |
38296479 |
T |
|
| Q |
221 |
cttttgtt-ttttcgtgagtatttatgcgttttgcatttatttgacgagaataat |
274 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38296478 |
cttttgtttttttcgtgagtatttatgcgttttgcatttatttgatgagaataat |
38296424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 97 - 233
Target Start/End: Original strand, 24018795 - 24018932
Alignment:
| Q |
97 |
attgtgaggtgtgggtatgcggttggtgcattgcacgttcgtatactccggcctcattgttttgggtagttttgaa-ctttggcttttgagaggtgttcc |
195 |
Q |
| |
|
||||||||| |||||||||||| |||||| | || ||| ||||||||||||| ||||| |||||||| ||||| |||| ||||||||| |||||||| |
|
|
| T |
24018795 |
attgtgaggcgtgggtatgcggctggtgcttcgcccgtgcgtatactccggcatcattattttgggtggttttttgtctttagcttttgaggggtgttcc |
24018894 |
T |
|
| Q |
196 |
gtatatttgcg-caccggattgtattcttttgttttttc |
233 |
Q |
| |
|
|||||| || | |||| | ||||||||| |||||||||| |
|
|
| T |
24018895 |
gtatatatgtgacacc-gtttgtattctattgttttttc |
24018932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University