View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_46 (Length: 276)
Name: NF1499_low_46
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 2820138 - 2820377
Alignment:
| Q |
19 |
tgaaaaccgtttcagctgatttgaccgttgatgggattcaaaatgagataagccaacaagtaatggaacttgtgctaaacttattgctaaccctgtcatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2820138 |
tgaaaaccgtttcagctgatttgaccgttgatgggattcaagatgagataagccaacaagtaatgtaacttgtgctaaacttattgctaaccctgtcatc |
2820237 |
T |
|
| Q |
119 |
cccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcccctaatcttttgttttgataatcaatgtggtttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2820238 |
cccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcccctaatcttttgttttgataatccatgtggtttt |
2820337 |
T |
|
| Q |
219 |
att-aatgatgacacatttggtagttctttttaggtacac |
257 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2820338 |
attgaatgatgacacatttggtagttctttttaggtacac |
2820377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 103 - 255
Target Start/End: Original strand, 2827550 - 2827707
Alignment:
| Q |
103 |
tgctaaccctgtca----tccccagattcttgtatgaaaatagtggatcacatcagctaagaaaatggttaattcattatcattcccctaatcttttgtt |
198 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2827550 |
tgctaaccctgtcaattgtccccggattcttgtatgaaaatactggatcacatcagctaggaaaatggttaattcattatcatttccctaatcttttgtt |
2827649 |
T |
|
| Q |
199 |
ttgataatcaatgtggttttatta-atgatgacacatttggtagttctttttaggtac |
255 |
Q |
| |
|
|| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2827650 |
ttaataatccatgtggttttattacatgatgacacatttggtagttctttttaggtac |
2827707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 2827309 - 2827392
Alignment:
| Q |
20 |
gaaaaccgtttcagctgatttgaccgttgatgggattcaaaatgagataagccaacaagtaatggaacttgtgctaaacttatt |
103 |
Q |
| |
|
|||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
2827309 |
gaaaaccgtttcagctgatttgacagctgctgggattcaaaatgagataagccaacaagtaatgtaacttgtgccaaacttatt |
2827392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University