View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_55 (Length: 241)
Name: NF1499_low_55
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 10469139 - 10469020
Alignment:
| Q |
19 |
aacaaagtaacgaaaccgtcattgtaagtgcaaattcttttcatgtcgttttcagccgttaaaacgattttgttatgtgtttcgttctgttgtga--ctc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
10469139 |
aacaaagtaacgaaaccgtcattgtaagtgcaaattcttttcatgtcgttttcagccgttaaaacgattttgttatgtgttgcgttctgttgtgactctc |
10469040 |
T |
 |
| Q |
117 |
tttaatcatatcttcaatta |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10469039 |
tttaatcatatcttcaatta |
10469020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 213 - 241
Target Start/End: Complemental strand, 10468948 - 10468920
Alignment:
| Q |
213 |
ctgttactattttaggactcctaagacgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10468948 |
ctgttactattttaggactcctaagacgc |
10468920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University