View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_56 (Length: 239)
Name: NF1499_low_56
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 97 - 238
Target Start/End: Complemental strand, 46813264 - 46813123
Alignment:
| Q |
97 |
catgaggtgttgtttttcaagaagttctcccgaaatcgttggtaaccaatgaaaatctgctcatggccacaattcacggaagttggtggatggaaataaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813264 |
catgaggtgttgtttttcaagaagttctcgcgaaatcgttggtaaccaatgaaaatatgctcatggccacaattcacggaagttggtggatggaaataaa |
46813165 |
T |
|
| Q |
197 |
attgatgggcccaactatagttataattgtgctatcggtgat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813164 |
attgatgggcccaactatagttataattgtgctatcggtgat |
46813123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 46813384 - 46813308
Alignment:
| Q |
18 |
aagttgtaacatggaaattttaccaaaccatgagactcatacacatccgcaactatagttccaaataaagcactcaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813384 |
aagttgtaacatggaaattttaccaaaccatgagactcatacacatccgcaactatagttccaaataaagcactcaa |
46813308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 112 - 229
Target Start/End: Complemental strand, 46904049 - 46903931
Alignment:
| Q |
112 |
ttcaagaagttctcccgaaatcgttggtaaccaatgaaaatctg-ctcatggccacaattcacggaagttggtggatggaaataaaatt-gatgggccca |
209 |
Q |
| |
|
|||||||||| ||| ||||||| ||| ||||||| |||||||| ||| ||||||||| |||||||||||||||| ||||||||||||| || || |||| |
|
|
| T |
46904049 |
ttcaagaagtgctcacgaaatccttgtcaaccaatcaaaatctggctc-tggccacaaatcacggaagttggtgggtggaaataaaattggacggaccca |
46903951 |
T |
|
| Q |
210 |
actatagttataattgtgct |
229 |
Q |
| |
|
||| ||| ||||||||||| |
|
|
| T |
46903950 |
gctacagtgataattgtgct |
46903931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University