View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1499_low_64 (Length: 226)
Name: NF1499_low_64
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1499_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 218
Target Start/End: Complemental strand, 279901 - 279706
Alignment:
| Q |
23 |
cattcatgtgactaatgcagagcactctaaccataatgatgatggtaatgttcacaaaaatgaggaacaaactacttcaattcctttggggaatgactca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279901 |
cattcatgtgactaatgcagagcactctaaccataatgatgatggtaatgttcacaaaaatgaggaacaaactacttcaattcctttggggaatgactca |
279802 |
T |
|
| Q |
123 |
agtttcgttgcagacaatcctgaccctcacactaacaataacactgatacaaccacagaaaaggacacatctgcatctgagccacaaaatgatgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
279801 |
agtttcgttgcagacaatcctgaccctcacactaacaataacactgatacaaccacagaaaaggacacatctgcatctgagccacaaaatgatgat |
279706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University