View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15000_high_11 (Length: 328)
Name: NF15000_high_11
Description: NF15000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15000_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 195 - 320
Target Start/End: Complemental strand, 4774870 - 4774745
Alignment:
| Q |
195 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774870 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
4774771 |
T |
|
| Q |
295 |
ctgcgaaatgtttctccagtataatc |
320 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
4774770 |
ctgcgaaatgtttctccagtaaaatc |
4774745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 4775046 - 4774941
Alignment:
| Q |
18 |
ctatgctgagacagttgatcctgatttgttaatatatcannnnnnnagccttttaagaaaatcagtcattgctaaattagtgtttatttaaggtattaac |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4775046 |
ctatgctgaaacagttgatcctgatttgttaatataccatttttttagccttttaagaaaatcagtcattgctaaattagtgtttatttaagatattaac |
4774947 |
T |
|
| Q |
118 |
cccaaa |
123 |
Q |
| |
|
|||||| |
|
|
| T |
4774946 |
cccaaa |
4774941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University