View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15000_high_12 (Length: 318)
Name: NF15000_high_12
Description: NF15000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15000_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 33769806 - 33769508
Alignment:
| Q |
1 |
caccaaccttggttggaaccgagtttccaaatatagtctaaacagtgcttcctcaagctcctcagctgaaagttcacttggctttttaacacaaaaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769806 |
caccaaccttggttggaaccgagtttccaaatatagtctaaacagtgcttcctcaagctcctcggctgaaagttcacttggctttttaacacaaaaactc |
33769707 |
T |
 |
| Q |
101 |
ctggcagaattgcacggaggactttctatccaaggcttgctgctcatgaaatattgcaacagctgaaacatttcaaaatataaatggttggcataaaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769706 |
ctggcagaattgcacggaggactttctatccaaggcttgctgctcttgaaatattgcaacagctgaaacatttcaaaatataaatggttggcataaaata |
33769607 |
T |
 |
| Q |
201 |
atttttaagtgctaatttaagctttaagaacctcctaagcaaatatcagacaacaaaatggg-gaaaatatcaacttgctgttcacataatggggaaaat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769606 |
atttttaagtgctaatttaagctttaagaa-ctcctaagcaaacatcagacaacaaaatgggcaaaaatatcaacttgctgttcacataatggggaaaat |
33769508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University