View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15000_low_8 (Length: 402)

Name: NF15000_low_8
Description: NF15000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15000_low_8
NF15000_low_8
[»] chr8 (2 HSPs)
chr8 (16-198)||(29533691-29533873)
chr8 (269-364)||(29533495-29533592)
[»] chr2 (1 HSPs)
chr2 (300-335)||(39401192-39401227)
[»] chr4 (1 HSPs)
chr4 (300-336)||(29597455-29597491)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 29533873 - 29533691
Alignment:
16 aaaggaacagtgatttcagtaataacaacaccccaaaagcataattgacctaggaaaacaaaaaggaatgtaatgctttatgaaattttggtgaatctgc 115  Q
    |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
29533873 aaaggaacagtgatttcagtaataacaacaccccaaaagcatgaatgacctaggaaaacaaaaaggaatgtaacgctttatgaaattttggtgaatctgc 29533774  T
116 gtatgatcaaatattgaatgtttcaaatcaacatgattttcagaaattaactacacgtgattaaaacttcaacttcataccct 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
29533773 gtatgatcaaatattgaatgtttcaaatcaacatgattttcagaaattaactacacgtgattaaaactccaacttcataccct 29533691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 269 - 364
Target Start/End: Complemental strand, 29533592 - 29533495
Alignment:
269 gcgtagaccaatgctagatttgaatccaatataaaaaagactcgtgtcatctcatctaaacgatcttacataaacata--aagatttgattcttatat 364  Q
    ||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||  ||||||||  ||||||||||||||||||    
29533592 gcgtagaccgatgctagatttaaatccaatataaaagagactcgtgtcatttcatctaaacgatcttatgtaaacatacgaagatttgattcttatat 29533495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 335
Target Start/End: Original strand, 39401192 - 39401227
Alignment:
300 taaaaaagactcgtgtcatctcatctaaacgatctt 335  Q
    ||||||||||||||||||||||||||||||| ||||    
39401192 taaaaaagactcgtgtcatctcatctaaacgttctt 39401227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 336
Target Start/End: Complemental strand, 29597491 - 29597455
Alignment:
300 taaaaaagactcgtgtcatctcatctaaacgatctta 336  Q
    ||||||| ||||||||||||||||||||||| |||||    
29597491 taaaaaaaactcgtgtcatctcatctaaacgctctta 29597455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University