View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15002_high_20 (Length: 258)
Name: NF15002_high_20
Description: NF15002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15002_high_20 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 7132421 - 7132685
Alignment:
| Q |
1 |
tttgtgtttccttcctttgttactaattttggagctcttcctctacacttttcctaatttt-tctgctatttgtttgtttctcttgatctttatggccaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7132421 |
tttgtgtttccttcctttgttactaattttggagctcttcctctacacttttcctaattttttctgctatttgtttgtttctcttgatctttatggccaa |
7132520 |
T |
 |
| Q |
100 |
caaactttttgcttgctatttcatctcccccttattgtaactctggcatcc-------------accaccatccatgatcatggctaacccaacgcccac |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7132521 |
caaactttttgcttgctatttcatctcccccttattgtaactctggcatccaccaccacgatgaaccaccatccatggtcatggctaacccaacgcccac |
7132620 |
T |
 |
| Q |
187 |
accctgaccaccagagccaccgcccaccacctccaacagatttggccgcagttgttcaaagccaccaaatat |
258 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
7132621 |
accctgaccaccagag-------ccaccacctccaacagatttggccacagttgttcaaagccacaaaatat |
7132685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 32 - 157
Target Start/End: Original strand, 7136404 - 7136528
Alignment:
| Q |
32 |
gagctcttcctctacacttttcctaatttttctgctatttgtttgtttctcttgatctttatggccaacaaactttttgcttgctatttcatctccccct |
131 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||| |||||| ||||||||| |||||| |||| ||||| ||||| |
|
|
| T |
7136404 |
gagctcttcctctatgcttttcctaatttttctgctatttgtttgcttctcttggtctctatggcaaacaaacttgttgctttctatgtcatcaccccc- |
7136502 |
T |
 |
| Q |
132 |
tattgtaactctggcatccaccacca |
157 |
Q |
| |
|
|||||||||| ||||||| |||||| |
|
|
| T |
7136503 |
gattgtaactccggcatccgccacca |
7136528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University