View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15002_high_9 (Length: 423)
Name: NF15002_high_9
Description: NF15002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15002_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 407
Target Start/End: Original strand, 41365010 - 41365415
Alignment:
| Q |
1 |
aatcaaacaatggactcaaatgactctaaaattacatttgatgatgaatcatccctaagcttcacaggtacgcaaaagcaattgtcactccacgttcttc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41365010 |
aatcaaacaatgaactcaaatgactctaaaattacatttgatgatgaatcatccctaagcttcacaggtacgcaaaagcaattgtcactccacgttcttc |
41365109 |
T |
|
| Q |
101 |
atgcaactcacaatctcgnnnnnnnnnnnnnnnnnnncaaaactaatgcgagtaattcagatccgcctggatcaagttaaagcactaatcatcaaatcaa |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41365110 |
atgcaactcacaatctcgttttcttttttcattttt-caaaactaatgcgggcaattcagatccgcctggatcaagttaaagcactaatcatcaaatcaa |
41365208 |
T |
|
| Q |
201 |
ttgtacccggattctttgatttcttcatcaagaatcttctcatcaaacacgattcttttgcgacacaatggctttcgtttcatgggtgtctttgttatta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41365209 |
ttgtacccggattctttgatttcttcatcaagaatcttctcatcaaacacgattcttttgcgacacaatggctttcgtttcatgggtgtctttgttatta |
41365308 |
T |
|
| Q |
301 |
tggttttcttcttgcagggtgcaccaggacattcaagaatcggtgggattttgtgatctgaagatgtgggagtcttgaacccatcattgttgttgtcgtg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41365309 |
tggttttcttcttgcagggtgcaccaggacattcaaaaatcggtgggattttgtgatctgaagatgtgggagtcttgaacccatcattgttgttgtcttg |
41365408 |
T |
|
| Q |
401 |
caatatt |
407 |
Q |
| |
|
||||||| |
|
|
| T |
41365409 |
caatatt |
41365415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University