View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15002_low_17 (Length: 314)
Name: NF15002_low_17
Description: NF15002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15002_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 8 - 297
Target Start/End: Original strand, 48756485 - 48756774
Alignment:
| Q |
8 |
agagaagaagtggggattttaggaaaattttgttgatacattggatataatatgcttgaataaggagaagagggttgtggttcaaacgataaaagagttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48756485 |
agagaagaagtggggattttaggaaaattttgttgatacgttggatataatatgcttgaataaggagaagagggttgtggttcgaacgataaaagagttt |
48756584 |
T |
|
| Q |
108 |
aatatgacattattagagaaatgatgttggacgttgataatgaatcatcgttgtttatgatataacgtcttagtggcacgttatggtgaggagcgggtgg |
207 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48756585 |
aatatgacattactagggaaatgatgttggacgttgaaaatgaatcatcgttgtttatgatataacatcttagtggcacgttatggtgaggagcgggtgg |
48756684 |
T |
|
| Q |
208 |
ttttgtgacaaagctaaattaggattaatttgtttgaaagatttgatgaatttgagtgtaggtgttggggtgagagtagacagttggttc |
297 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48756685 |
tcttgtgacaaagctaaattaggattaatttgtttgaaagatttgatgaatttgagtgtaggtgttggggtgagagtagacacttggttc |
48756774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University