View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15002_low_19 (Length: 288)
Name: NF15002_low_19
Description: NF15002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15002_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 288
Target Start/End: Complemental strand, 38108809 - 38108517
Alignment:
| Q |
12 |
tactactgatttttagcacactctcttttttcccctacctcttacaccttaaccaagttagggaataaaagtcacagtaaactagctatattaccaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38108809 |
tactactgatttttagcacactctcttttttcccct----cttacaccttaaccaagttagggaataaaagtcacagtaaactaactatattaccaatgt |
38108714 |
T |
 |
| Q |
112 |
gagttttgtaattgaaatcacaaaacacatttgattacagtaaatttgat--------------------gtaaaatgattcataacgtgaaagatatac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38108713 |
gagttttgtaattgaaatcacaaaacacgtttgattgcagtacatttgatagtatgttatccagtaagatgtaaaatgattcataacgtgaaagatatac |
38108614 |
T |
 |
| Q |
192 |
ttgttcgtaaaatgtaacttttttagcagcttcttaaaactcaacggttgacctatatatgtaaatcatagatcaaccgttgaattttcttttaatc |
288 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38108613 |
ttgttcgtaaaatgtaacttttttagccgcttcttaaaactcaacggttgacctatatatgtaaatcatagatcaaccgttgaattttcttttaatc |
38108517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University