View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15004_high_11 (Length: 208)
Name: NF15004_high_11
Description: NF15004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15004_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 88 - 208
Target Start/End: Original strand, 34306697 - 34306813
Alignment:
| Q |
88 |
agtaatgatggagtttgatcctttcactcgtgcgtgccatatatgtactgaaagaagacacactctgtgattttactatcaaaatctatgcatgcaacat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306697 |
agtaatgatggagtttgatcctttcactcgtg----ccatatatgtactgaaagaagacacactatgtgattttactatcaaaatctatgcatgcaacat |
34306792 |
T |
|
| Q |
188 |
gtcattcactttgatacttct |
208 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34306793 |
gtcattcactttgatacttct |
34306813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University