View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15004_high_3 (Length: 514)
Name: NF15004_high_3
Description: NF15004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15004_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 6e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 72 - 225
Target Start/End: Complemental strand, 15595967 - 15595814
Alignment:
| Q |
72 |
tttctgagcaacttcgactcttaggatatatcataaccgataggtctctgcttaggttcaaaacaatttgtagagaggttcaacaacaaaggacacataa |
171 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| | || ||||||||||||| || ||||| | | | || |||||||||||||| |
|
|
| T |
15595967 |
tttctgagcaacttcgacccttaggatatatcataaccgatagattactccttaggttcaaaataacttgtacatgaatgtaccatcaaaggacacataa |
15595868 |
T |
 |
| Q |
172 |
aatcttgctacttaaattttgcttaacgtcatcatattaccgatatttatcata |
225 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
15595867 |
acccttgctacttaaattttgcttaacatcatcatattggcgatacttatcata |
15595814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 457 - 503
Target Start/End: Complemental strand, 14734789 - 14734743
Alignment:
| Q |
457 |
ccgattccatccctctttaccttgaaaacacattcgaaaataccttt |
503 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14734789 |
ccgattccatctctcttgaccttgaaaacacattcgaaaataccttt |
14734743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University