View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15004_high_9 (Length: 300)
Name: NF15004_high_9
Description: NF15004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15004_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 75 - 167
Target Start/End: Original strand, 14948701 - 14948793
Alignment:
| Q |
75 |
ctcagtatgaacaataatagggtggtgatcagactgcacatgcggaaagactttagctatcccatcgtgaaatctcaatctccaactgacatt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14948701 |
ctcagtatgaacaataatagggtggtgatcatactgcacacccgaaaagactttagctatcccatcatgaaatctcaatctccaactgacatt |
14948793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 14948223 - 14948289
Alignment:
| Q |
1 |
cttttataaattgcatactttcagaaccaaattaaacatcaaactctcaaatatacaaaatcaatct |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14948223 |
cttttataaattgcatactttcagaaccaaattaaatatcaaactctcaaatatacaaaatcaatct |
14948289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 186 - 284
Target Start/End: Original strand, 14948838 - 14948930
Alignment:
| Q |
186 |
tccacttaggtcccctccaagtaaacttagtccctgttgtagtaacctccatcaaactacggtcatgtcattgattcgattgttaaaattctgacattt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||| |||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
14948838 |
tccacttaggtcccctccaagtaaacttagt-cctgctgtagtaacttccatcaacctacg-----gtgattgattcgattgttaaaattctgacattt |
14948930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University