View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15004_low_10 (Length: 241)
Name: NF15004_low_10
Description: NF15004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15004_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 14580920 - 14581125
Alignment:
| Q |
1 |
agtgtgtggttttatagtgcacaaggaaaatttgaattcaactttgttttttgactcaacttgtgaaatctattgtaataatgataatggtgctacggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14580920 |
agtgtgtggttttatagtgcacaaggacaatttgaattcaactttgttttttgactcaacttgtgaaatctattgtaataatgataatggtgctacggtg |
14581019 |
T |
|
| Q |
101 |
gctgattgacatgtactgtttgcaagtggttgcttaccactggtcactggtggaccaggaatattataggaacatgcactaagatttacgaggttattta |
200 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
14581020 |
gctgtttgatatgtaccgtttgcaagtggttacttaccactggtcactggtggaccaggaatattataggaacatgcactaagatttacgaggcttttta |
14581119 |
T |
|
| Q |
201 |
tttatt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
14581120 |
tttatt |
14581125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 206
Target Start/End: Complemental strand, 14542518 - 14542462
Alignment:
| Q |
150 |
gtggaccaggaatattataggaacatgcactaagatttacgaggttatttatttatt |
206 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
14542518 |
gtggaccagaaatattatatgaacatgcactgagatttatgaggtttattatttatt |
14542462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 14542671 - 14542598
Alignment:
| Q |
1 |
agtgtgtggttttatagtgcacaaggaaaatttgaattcaactttgttttttgactcaacttgtgaaatctatt |
74 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || || ||| | ||||| ||||||| || ||||||||||| |
|
|
| T |
14542671 |
agtgtgtggctttatagtgcacaaagacaatttaaaatctactatttttttggactcaatttctgaaatctatt |
14542598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University