View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15005_high_21 (Length: 303)
Name: NF15005_high_21
Description: NF15005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15005_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 6027208 - 6026911
Alignment:
| Q |
1 |
caacaagatttttgcttcagccgttaaagaacttccacagcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt-aatcg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6027208 |
caacaagatttttgcttcagccgttaaagaacttccacggcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttttaatcg |
6027109 |
T |
|
| Q |
100 |
attcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagcaaaatca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027108 |
attcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagcaaaatca |
6027009 |
T |
|
| Q |
200 |
ccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaaggtgatgatgattatgattatgactatg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027008 |
ccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaaggtgatgatgattatgattatgactatg |
6026911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University