View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15007_high_11 (Length: 275)
Name: NF15007_high_11
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15007_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 51252846 - 51252942
Alignment:
| Q |
1 |
atggctgcactttgtcctggtcaagatgaatgctctcttgccatttacctctctggtttccaacaagttgtgagtgttcatctcttttctaccatct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51252846 |
atggctgcactttgtcctggtcaagatgaatgctctcttgccatttacctctctggtttccaacaagttgtgagtgttcatctcttttctaccatct |
51252942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 168 - 243
Target Start/End: Original strand, 51253079 - 51253154
Alignment:
| Q |
168 |
ggttctcaccattttctgggtacaatgctcttctcataaaaacaactgtctagcagctacaataacgcttcttttc |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51253079 |
ggttgtcaccattttctgggtacaatgctcttctcataaaaacaactgtctagcagctacaataacgcttcttttc |
51253154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 156
Target Start/End: Original strand, 51252995 - 51253026
Alignment:
| Q |
125 |
ttccgacaccaacatatatgattatattttat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51252995 |
ttccgacaccaacatatatgattatattttat |
51253026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 53598850 - 53598916
Alignment:
| Q |
1 |
atggctgcactttgtcctggtcaagatgaatgctctcttgccatttacctctctggtttccaacaag |
67 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| ||||||| || ||| ||||||| ||||||| |
|
|
| T |
53598850 |
atggctgctctttgtcccggacaagatgaatgctcaattgccatctatctcactggttttcaacaag |
53598916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University