View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15007_high_12 (Length: 266)
Name: NF15007_high_12
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15007_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 31623298 - 31623186
Alignment:
| Q |
1 |
taatcaaaatttaggagtctagtcaagtttggactattctatgcttgctaaaagagttaggtttggactatgctatgcttcccgacaatataatcacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31623298 |
taatcaaaatttaggagtctagtcaagtttggactattctatgcttgctaaaagagttaggtttggactatgctatgcttcccgacaatataatcacaaa |
31623199 |
T |
 |
| Q |
101 |
caaagaatccttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31623198 |
caaagaatccttt |
31623186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 165 - 248
Target Start/End: Complemental strand, 31623137 - 31623052
Alignment:
| Q |
165 |
gttgctctaaacttttggttaaagcaagcagttaagtgt--tttattcacaatagttcaattttcaagtcttgatcataaatcaag |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31623137 |
gttgctctaaacttttggttaaagcaagcagttaagtgtaatttattcacaatagttcaattttcaagtcttgatcataaatcaag |
31623052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University