View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15007_high_14 (Length: 247)
Name: NF15007_high_14
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15007_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 76 - 209
Target Start/End: Complemental strand, 36318797 - 36318664
Alignment:
| Q |
76 |
ttattctcagatagccatgtatgtgtgaataggcacaaagttacaaagacaaagctgcttttcttctgaaatacacacaaatgacaacaaggagcagtca |
175 |
Q |
| |
|
||||| || |||| |||||||||||| |||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
36318797 |
ttattatcggatacccatgtatgtgttaataggcacaaatttacaaagacaaagttgcttttcttctgacatacacacaaatgacaacacggagcagtca |
36318698 |
T |
|
| Q |
176 |
aaataatcaaaaaatcaatatacatgctccacgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36318697 |
tcataatcaaaaaatcaatatacatgctccacgg |
36318664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 77
Target Start/End: Complemental strand, 36319218 - 36319152
Alignment:
| Q |
11 |
cagagaagtcattattaagagggataaaagatgaaatattgatagaatgacaacactgaacaaagtt |
77 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36319218 |
cagagaagtcattatcaagagggataaaagatgaaatattgatagaatgacaacacgaaacaaagtt |
36319152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University