View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15007_high_18 (Length: 206)
Name: NF15007_high_18
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15007_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 44528675 - 44528843
Alignment:
| Q |
17 |
agaacgcatgcattgtcttacaacattgacatataaggcaatctcatgtccattgtgatctgtatgaaatgttgttt-aaaaatattgttagctttattg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44528675 |
agaacgcatgcattgtcttacaacattgacatataagacaatctcatgtccattgtgatctgtatgaaatgtttttttaaaaatattgttagctttattg |
44528774 |
T |
 |
| Q |
116 |
tctaaaatgtatgttgattttgaattgctagcaaggagatgaaatgtttacggattgaacctttgtgat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44528775 |
tctaaaatgtatgttgattttgaattgctagcaaggagatgaaatgtttgcggattgaacctttgtgat |
44528843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University