View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15007_low_6 (Length: 411)
Name: NF15007_low_6
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15007_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 57 - 405
Target Start/End: Complemental strand, 33042996 - 33042671
Alignment:
| Q |
57 |
attttatttaattcactcccaatatgcctcaaagatacaactacaagtaatttaattccctaccaatatccttcaaagtgaacgtcaatggtccctttca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33042996 |
attttatttaattcactcccaatatgcctcaaagatacaactacaagtaatttaattccctaccaatatccttcaaagtgaacgtcaatgatccctttca |
33042897 |
T |
 |
| Q |
157 |
tttttggggagtactgttgtggtggcctcatcagagatgaccatggtaatatctagtccagggtttctacttaatatcatacctacttctgctcgactgc |
256 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33042896 |
tttttggggagtactgttgtggtgacctcatcagagatgaccatggtaatatctagtccagggtttctacttaatatcatacctacttctgctcaac--- |
33042800 |
T |
 |
| Q |
257 |
aatgcaagtcctttcttataagcccctcattttcttaccgtaaaattggaatccttcaatctagttgatcaggaatccaataagtgtacatattttgagg |
356 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042799 |
--tgcaagtcctttctta-----ccgt-------------taaaattggaatccttcaatctagttgatcaggaatccaataagtgtacatattttgagg |
33042720 |
T |
 |
| Q |
357 |
cttccattgagtttatcctcttctacatggtttgcttaatgatgatgtc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042719 |
cttccattgagtttatcctcttctacatggtttgcttaatgatgatgtc |
33042671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University