View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15009_low_16 (Length: 231)
Name: NF15009_low_16
Description: NF15009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15009_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 215
Target Start/End: Original strand, 34203260 - 34203461
Alignment:
| Q |
14 |
attatactttcatgtatccatgacaatgataataaaactaatcattttaagaaacaaagatgatacctactccttataccatttgttccgtaagtttgat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34203260 |
attagactttcatgtatccatgacaatgataataaaactaatcattttgagaaacaaagatgatacctactccttataccatttgttccgtaagtttgat |
34203359 |
T |
|
| Q |
114 |
atcagtgcttcaaggaagtttggaggtttaagatccctcttttgcaacagtgctatagctattgacttggtggttttcgttgactatagctacagtgcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34203360 |
atcagtgcttcaaggaagtttggaggtttaagatccctcttttgcaacagtgctatagctattgacttggtggttttcgttgactatagctacagtgcta |
34203459 |
T |
|
| Q |
214 |
ta |
215 |
Q |
| |
|
|| |
|
|
| T |
34203460 |
ta |
34203461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University