View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15009_low_18 (Length: 219)
Name: NF15009_low_18
Description: NF15009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15009_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 14 - 202
Target Start/End: Complemental strand, 53479265 - 53479074
Alignment:
| Q |
14 |
atgaattgcaattaaatttagaataggttcatcaagt---cattcattagaattagagtagaataatggagagctcgcatgtcatttctcagtctccttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479265 |
atgaattgcaattaaatttagaataggttcatcaagttttcattcattagaattagagtagaataatggagagctcgcatgtcatttctcagtctccttt |
53479166 |
T |
 |
| Q |
111 |
acctttaatttctcacacactttttcttttagtcatacatacaacagcaacaaatatagaaagccacctaattgaatctgaagggaatttca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53479165 |
acctttaatttctcacacactttttcttttagtcatacatacaacagcaacaaatatagaaagccacctaattgaatgtgaagggaatttca |
53479074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University