View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_16 (Length: 422)
Name: NF1500_high_16
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 180 - 404
Target Start/End: Complemental strand, 46556909 - 46556685
Alignment:
| Q |
180 |
gtgatggagaaagcagtgatgaaggtaaccaaaccgatggtggcaacgaaaacgaagctgttaaggttgttgttgctgctaccgaaggtggtagtggtgg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556909 |
gtgatggagaaagcagtgatgaaggtaaccaaaccgatggtggcaacgaaaacgaagctgttaaggttgttgttgctgctaccgaaggtggtagtggtgg |
46556810 |
T |
 |
| Q |
280 |
tggatggccacccggaagaggcggtgtacaatttcaagaaataaagccagaggtgagacatgttacgagttttccagccggtaaccagttaccggttgca |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46556809 |
tggatggccacccggaagaggcggtgtacaatttcaagaaataaagccagaggtgagacatgttacgagttttccagccggtaaccagttaccggttgca |
46556710 |
T |
 |
| Q |
380 |
gagaaaaaagttacaatggccatgg |
404 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46556709 |
gagaaaaaagttacaatggccatgg |
46556685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 46557079 - 46556986
Alignment:
| Q |
10 |
agaagcaaaggggactgtcgacaccgatacactgattaagatactaacacaaaccggtaaacgagctgagttatggcctgatacagaaccaatc |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557079 |
agaagtaaaggggactgtcgacaccgatacactgattaagatactaacacaaaccggtaaacgagctgagttatggcctgatacagaaccaatc |
46556986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University