View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_36 (Length: 293)
Name: NF1500_high_36
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 286
Target Start/End: Original strand, 52205359 - 52205630
Alignment:
| Q |
18 |
aggtacatggagaaatttttgctaggcctcttttaccttggaggtatgttatgtttttatcaacatgccagtgtggtgcgtagttttgtactattatcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52205359 |
aggtacatggagaaatttttgctaggcctcttttacctttgaggtatgttatgtttttatcaacatgccagtgtggtgcgtagttttgtactattatcca |
52205458 |
T |
|
| Q |
118 |
aacaactctcttcctaatatttagttgcaagccttgaaggtgggttggattcgtttaaatacagacaaagctagtattaaaggcggaacttatggtgatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52205459 |
aacaactctcttcctaatatttagttgcaagccttcaaggtgggttggattcgtttaaatacagacaaagctagtattaaaggcggaacttatggtgatg |
52205558 |
T |
|
| Q |
218 |
tgattcgtaagaaagatgacaactgcttgtgtaatttctcgtag---ttttttagtcggtctagtacctatg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
52205559 |
tgattcgtaagaaagatgacaactgcttgtgtaatttctcgtagtttttttttagtcggtctagtacttatg |
52205630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University