View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_44 (Length: 258)
Name: NF1500_high_44
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 936378 - 936151
Alignment:
| Q |
18 |
ctaaaccctcctcgtcaatcattatatgtatagcatcaaatttagcatcccaggcttcattctttccgagtgagtgattcctggatgttaaaaaattcaa |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
936378 |
ctaaaccctccttgtcaatcattatatgtatagcatcaaatttagcatcccaggcttcatgctttccgagtgagtgattcctggatgttaagaaattcaa |
936279 |
T |
 |
| Q |
118 |
atacgcacataaacaaaaattgtgtaacttgtgtcaaaagcattgctaaaagccccataaacggctttgccttcacggcttcaccccatgaggaagcttt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
936278 |
atacgcacataaacaaaaattctgtaacttgtgtcaaaagcattgctaaaagccccataaacggctttgccttcacggcttcaccccatgaggaagcttt |
936179 |
T |
 |
| Q |
218 |
ctctttttgcattctactttttgctcct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
936178 |
ctctttttgcattctactttttgctcct |
936151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University