View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_59 (Length: 238)
Name: NF1500_high_59
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 36 - 189
Target Start/End: Complemental strand, 2656515 - 2656362
Alignment:
| Q |
36 |
agtttcatattaaaatagacagttgaacaagtggaccaaataatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaac |
135 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656515 |
agtttcaatttaaaatagacagttgaacaagtggaccaaatgatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaac |
2656416 |
T |
 |
| Q |
136 |
tatatgtgaacctgagaccagtttgaaatggtactttcgttcatgtacctagtg |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
2656415 |
tatatgtgaacctgagaccagtttggaatggtactttcgttcatgtacccagtg |
2656362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3685511 - 3685558
Alignment:
| Q |
1 |
ttggtaaatatcattacatattcacttagatttatagtttcatattaa |
48 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
3685511 |
ttggtaaataccattacatattctcttagtgttatagtttcatattaa |
3685558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University