View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1500_high_59 (Length: 238)

Name: NF1500_high_59

Description: NF1500

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1500_high_59

[»] chr4 (1 HSPs)

[»] chr8 (1 HSPs)

Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 134; E-Value: 7e-70

Query Start/End: Original strand, 36 - 189

Target Start/End: Complemental strand, 2656515 - 2656362

Alignment:

Q	36	agtttcatattaaaatagacagttgaacaagtggaccaaataatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaac	135	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	2656515	agtttcaatttaaaatagacagttgaacaagtggaccaaatgatcattactaattgatgatcattattatgcaggtatgtcaaggatttgttcttgcaac	2656416	T

Q	136	tatatgtgaacctgagaccagtttgaaatggtactttcgttcatgtacctagtg	189	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|
T	2656415	tatatgtgaacctgagaccagtttggaatggtactttcgttcatgtacccagtg	2656362	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 32; E-Value: 0.000000005

Query Start/End: Original strand, 1 - 48

Target Start/End: Original strand, 3685511 - 3685558

Alignment:

Q	1	ttggtaaatatcattacatattcacttagatttatagtttcatattaa	48	Q
		\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	3685511	ttggtaaataccattacatattctcttagtgttatagtttcatattaa	3685558	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]