View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1500_high_60 (Length: 234)
Name: NF1500_high_60
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1500_high_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 47648766 - 47648564
Alignment:
| Q |
13 |
cataggcaatactttgagtttgttgaaatcaatgagcacccccaccatagaaaggcaatattgttttccaaatttacatatggataatgcttacttgaag |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648766 |
catagacaatactttgagtttgttgaaatcaatgagcacccccaccacagaaaggcaatattgttttccaaatttacatatggataatgcttacttgaag |
47648667 |
T |
|
| Q |
113 |
attggtaagtgttttgagtgagttgtgggttcttgactcttggtggaatatgagtatcataacgcggaaaaacacacgttcacctaaaatattaagactg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648666 |
attggtaagtgttttgagtgagttgtgggttcttgactcttggtggaatatgagtatcataacgcggaaaaacacacgttcacctaaaatattaagactg |
47648567 |
T |
|
| Q |
213 |
agt |
215 |
Q |
| |
|
||| |
|
|
| T |
47648566 |
agt |
47648564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University